Question and answer
What is the difference between DNA and RNA? DNA is a protein and RNA is a nucleic acid.DNA uses deoxyribose and RNA uses ribose.DNA has adenine and RNA has thymine.DNA has thymine and RNA has uracil. Question #3TextMultipleChoice Score: The presence of paired chromosomes makes a haploidgametediploidgerm cell, while a single member of a pair of chromosomes makes a somaticgametehaploiddiploid cell. Question #4TrueFalse Score: If an enzyme is absent during polypeptide production, a mutation can occur. TrueFalse Question #5MultipleChoice Score: If the sperm gamete that fertilizes an egg has a(n)
_____ chromosome, it will form male offspring. XYXYXX Question #6TextMultipleChoice Score: Mendel's principle of dominance suggests a recessivedominantdiploid gene will always be masked by the presence of a recessivehaploiddominant gene. Question #7MultipleChoice Score: Conducting a monohybrid cross of F1 generation plants, the recessive trait reappears in F2 plants in a ratio of _____. 1:12:13:14:1 Question #8TextMultipleChoice Score: You can physically see the phenotypegenotype of a trait, but not the genotypephenotype . Question #9MultipleChoice Score: A plant with the genotype TT is called _____. homozygousheterozygoushybrid Question #10MultipleChoice Score: You have a plant with yellow seeds, which express a dominant phenotype. How would you determine the plant's genotype? Conduct a Punnett square with a purebred recessive plant.Conduct a test cross with a purebred recessive plant.Conduct a test cross with a purebred dominant plant.Conduct a test cross with a hybrid plant. Question #11TrueFalse Score: A Tt plant crossed with a Tt plant will have a 25% chance of having a tt offspring each time they reproduce. TrueFalse Question #12MultipleChoice Score: Which of the following is the correct matching nucleotide sequence for CTAGG? CTAGGGATCCGGATCAGCTT Question #13MultipleChoice Score: DNA _____. cannot determine behavior traitsis enclosed by a nuclear membrane in prokaryotescontains coded information for the creation of proteinsis a long, single chain of nucleotides Question #14MultipleSelect Score: Select all that apply. Chromosomes _____. are tight coils of DNAare carried on genesalways occur in pairscan be analyzed in a karyotypecarry thousands of genes Question #15MultipleChoice Score: Suppose you have monohybrid pea plants in your garden and find that they produce round seeds to wrinkled seeds in the ratio of 3:1. If the alleles are designated R and r, respectively, what are the probable genotypes of the wrinkled seeds produced by your plants? RR & RrRR onlyRR & rrRr onlyrr only Question #16TextMultipleChoice Score: With the following crosses of pea plants, give the flower color of offspring and the ratio expected (red is dominant). A cross of red x red (both homozygous) would result in all red3 red, 1 white2 red, 2 white1 red, 3 white. Question #17MultipleChoice Score: After crossing purebred red (dominant) and purebred white (recessive) flowers, pink flowers appeared. Using symbols, show the cross between pink and white flowers. Rr x rrRR x rrRr x RR Question #18MultipleChoice Score: The second generation phenotypes resulting from the cross of purebred monohybrid pollination will display a ratio of _____. 4:14:13:1none of the above Question #19MultipleChoice Score: If you flip two coins, the probability that both will come up heads is _____. 1/41/23/40/4 Question #20MultipleChoice Score: A mouse with curled whiskers migrates from one forest community to another. She mates with other mice in the new community and passes the gene for curled whiskers to her offspring. This is an example of _____. genetic driftmutationgene flownatural selection Question #21MultipleChoice Score: Which of the following statements is true? Acquired mutations are passed down from parent to offspring.Mutations are the most fundamental way to add new genes to a gene pool.Hereditary mutations are caused by external factors, such as radiation.Only somatic mutations are important to evolution because they can be inherited. Question #22MultipleChoice Score: Which of the following statements is true? All mutations cause evolution.Any change to the DNA of an organism is called evolution.All mutations are harmful.Evolution happens slowly over time. Question #23MultipleChoice Score: Mr. Henley said, "In the rat race we call life, only the strong will survive." He may have been referring to _____. natural selectioncoevolutionconvergent evolutiongenetic drift Question #24TextMultipleChoice Score: Punctuated equilibriumGradualism is a slow, continuous process while gradualismpunctuated equilibrium is sudden and less frequent. Question #25TextMultipleChoice Score: Convergent evolutionDivergent evolutionCoevolution is when different organisms evolve similar characteristics while divergent evolutioncoevolutionconvergent evolution evolution is when similar organisms evolve differently. Question #26MultipleChoice Score: Microevolution _____. explores the connection between organisms of different speciesrefers to evolution at or below the species levelquestions how organisms become extinctrefers to evolution above the species level Question #27MultipleChoice Score: Comparative _____ suggests organisms that are more closely related have more similar embryo development. morphologyembryologyfossil records
s
2. The main difference between DNA and RNA nucleotides is: DNA has thymine as a nucleotide, while RNA has uracil.
Expert answered|Wallet.ro|Points 263388|
Question|Rated good
Asked 6 days ago|8/4/2022 12:20:08 PM
Updated 6 days ago|8/4/2022 1:46:41 PM
24 Answers/Comments
This answer has been confirmed as correct and helpful.
Get an answer
New answers
Rating
3
3. The presence of paired chromosomes makes a diploid cell, while a single member of a pair of chromosomes makes a haploid cell.
Added 6 days ago|8/4/2022 1:34:39 PM
This answer has been confirmed as correct and helpful.
3
4. If an enzyme is absent during polypeptide production, a mutation can occur. TRUE.


Added 6 days ago|8/4/2022 1:35:15 PM
This answer has been confirmed as correct and helpful.
3
5. If the sperm gamete that fertilizes an egg has an Y chromosome, it will form male offspring.

Added 6 days ago|8/4/2022 1:35:45 PM
This answer has been confirmed as correct and helpful.
3
6. Mendel's principle of dominance suggests a recessive gene will always be masked by the presence of a dominant gene.

Added 6 days ago|8/4/2022 1:36:16 PM
This answer has been confirmed as correct and helpful.
3
7. Conducting a monohybrid cross of F1 generation plants, the recessive trait reappears in F2 plants in a ratio of 3:1.

Added 6 days ago|8/4/2022 1:36:48 PM
This answer has been confirmed as correct and helpful.
3
8. You can physically see the phenotype of a trait, but not the genotype.
Added 6 days ago|8/4/2022 1:37:20 PM
This answer has been confirmed as correct and helpful.
3
9. A plant with the genotype TT is called homozygous.
Added 6 days ago|8/4/2022 1:37:45 PM
This answer has been confirmed as correct and helpful.
3
10. You have a plant with yellow seeds, which express a dominant phenotype. You would determine the plant's genotype by 'Conducting a testcross with a purebred recessive plant'.


Added 6 days ago|8/4/2022 1:38:02 PM
This answer has been confirmed as correct and helpful.
3
11. A Tt plant crossed with a Tt plant will have a 25% chance of having a tt offspring each time they reproduce. TRUE.

Added 6 days ago|8/4/2022 1:38:38 PM
This answer has been confirmed as correct and helpful.
3
12. GATCC is the correct matching nucleotide sequence for CTAGG.

Added 6 days ago|8/4/2022 1:39:08 PM
This answer has been confirmed as correct and helpful.
3
13. DNA: contains coded information for the creation of proteins.

Added 6 days ago|8/4/2022 1:39:44 PM
This answer has been confirmed as correct and helpful.
3
14. Chromosomes: are tight coils of DNA; always occur in pairs; can be analyzed in a karyotype; carry thousands of genes.
Added 6 days ago|8/4/2022 1:40:13 PM
This answer has been confirmed as correct and helpful.
3
15. Suppose you have monohybrid pea plants in your garden and find that they produce round seed to wrinkled seeds in the ratio of 3:1 If the allele are designated (R & r) respectively, The probable genotypes of the round seeds which were produced is Rr only.
Added 6 days ago|8/4/2022 1:40:47 PM
This answer has been confirmed as correct and helpful.
3
17. After crossing purebred red (dominant) and purebred white (recessive) flowers, pink flowers appeared. Using symbols, the cross between pink and white flowers is:
The results indicate that the cross between pink and white flowers will produce a ratio of 1:1

Rr x rr
Added 6 days ago|8/4/2022 1:42:09 PM
This answer has been confirmed as correct and helpful.
3
18. The second generation phenotypes resulting form the cross of purebred monohybrid pollination will display a ratio of 3:1.
Added 6 days ago|8/4/2022 1:42:23 PM
This answer has been confirmed as correct and helpful.
3
19. If you flip two coins, the probability that both will come up heads is: 1/4
Added 6 days ago|8/4/2022 1:42:35 PM
This answer has been confirmed as correct and helpful.
3
20. A mouse with curled whiskers migrates from one forest community to another. She mates with other mice in the new community and passes the gene for curled whiskers to her offspring. This is an example of gene flow.
Added 6 days ago|8/4/2022 1:42:48 PM
This answer has been confirmed as correct and helpful.
3
21. Mutations are the most fundamental way to add new genes to a gene pool, is a true statement.
Added 6 days ago|8/4/2022 1:43:20 PM
This answer has been confirmed as correct and helpful.
3
22. The following statements is true: Evolution happens slowly over time.

Added 6 days ago|8/4/2022 1:44:10 PM
This answer has been confirmed as correct and helpful.
3
23. Mr. Henley said, "In the rat race we call life, only the strong will survive." He may have been referring to natural selection.
Added 6 days ago|8/4/2022 1:44:58 PM
This answer has been confirmed as correct and helpful.
3
24. Gradualism is a slow, continuous process while Punctuated equillibrium is sudden and less frequent.


Added 6 days ago|8/4/2022 1:45:09 PM
This answer has been confirmed as correct and helpful.
3
25. Convergent Evolution is when different organisms evolve similar characteristics while divergent evolution is when similar organisms evolve differently.
Added 6 days ago|8/4/2022 1:45:47 PM
This answer has been confirmed as correct and helpful.
3
26. Microevolution refers to evolution at or below the species level.
Added 6 days ago|8/4/2022 1:46:19 PM
This answer has been confirmed as correct and helpful.
3
27. Comparative embryology suggests organisms that are more closely related have more similar embryo development.
Added 6 days ago|8/4/2022 1:46:41 PM
This answer has been confirmed as correct and helpful.
Comments

There are no comments.

Add an answer or comment
Log in or sign up first.
36,392,027
questions answered
Popular Conversations
What is the difference between DNA and RNA? DNA is a protein and RNA ...
Weegy: 2. The main difference between DNA and RNA nucleotides is: DNA has thymine as a nucleotide, while RNA has ...
8/4/2022 12:20:08 PM| 24 Answers
A child s temperament is primarily influenced by _______ factors. The ...
Weegy: A child s temperament is primarily influenced by BIOLOGICAL factors.
8/4/2022 1:10:34 AM| 16 Answers
A society that is dominated by men is called _____.
Weegy: A society dominated by men is called patriarchy. User: Communism a classless society where control of wealth ...
8/3/2022 7:01:40 PM| 15 Answers
"I don't like coffee." "______ do I."* So Neither Either No Is Jo ...
Weegy: I don't like coffee." "NEITHER do I."
8/10/2022 6:05:13 AM| 14 Answers
The correct plural of the noun attorney is _attorney. The primary ...
Weegy: The correct plural of the noun attorney is attorneys.
8/1/2022 11:49:42 AM| 12 Answers
The correct plural of the noun attorney is _______. The primary ...
Weegy: The correct plural of the noun attorney is attorneys.
8/9/2022 8:18:09 PM| 12 Answers
Questions 1 10: For each blank, write a word that is an antonym of ...
Weegy: 1. He couldn?t bear the cold of Alaska after living in the __________ of Texas. 2. He has been accused of ...
8/9/2022 8:26:35 PM| 10 Answers
S
L
Points 241 [Total 789] Ratings 0 Comments 131 Invitations 11 Offline
S
L
Points 215 [Total 225] Ratings 5 Comments 155 Invitations 1 Offline
S
L
Points 199 [Total 291] Ratings 1 Comments 189 Invitations 0 Online
S
L
P
R
Points 194 [Total 1943] Ratings 0 Comments 194 Invitations 0 Offline
S
L
R
Points 123 [Total 1597] Ratings 1 Comments 113 Invitations 0 Offline
S
L
Points 118 [Total 414] Ratings 0 Comments 118 Invitations 0 Offline
S
L
P
Points 102 [Total 1066] Ratings 1 Comments 92 Invitations 0 Offline
S
L
Points 78 [Total 238] Ratings 1 Comments 68 Invitations 0 Offline
S
L
Points 71 [Total 841] Ratings 1 Comments 61 Invitations 0 Offline
S
Points 66 [Total 66] Ratings 0 Comments 66 Invitations 0 Offline
* Excludes moderators and previous
winners (Include)
Home | Contact | Blog | About | Terms | Privacy | © Purple Inc.