Question and answer
Chromosomes _____. are tight coils of DNA are carried on genes always occur in pairs can be analyzed in a karyotype carry thousands of genes
Question
Asked 1/29/2013 1:01:41 PM
Updated 3/8/2014 6:06:49 AM
2 Answers/Comments
Edited by Janet17 [3/8/2014 6:00:05 AM], Edited by Janet17 [3/8/2014 6:04:41 AM]
s
Get an answer
Original conversation
User: Chromosomes _____. are tight coils of DNA are carried on genes always occur in pairs can be analyzed in a karyotype carry thousands of genes

Weegy: All the statements are true. Chromosomes are tight coils of DNA, are carried on genes, always occur in pairs, can be analyzed in a karyotype, and carry thousands of genes.
stnaluK|Points 410|

User: Which of the following is the correct matching nucleotide sequence for CTAGG?

User: Punctuated equilibriumGradualism is a slow, continuous process while punctuated equilibriumgradualism is sudden and less frequent

User: If the sperm gamete that fertilizes an egg has a(n) _____ chromosome, it will form male offspring

Weegy: If the sperm gamete that fertilizes an egg has a Y chromosome, it will form male offspring.
allybee|Points 8815|

User: If an enzyme is absent during polypeptide production, a mutation can occur.

Weegy: false
cdfan76|Points 1064|

User: Mr. Henley said, "In the rat race we call life, only the strong will survive." He may have been referring to

Weegy: Natural selection.
aaaaaaaaaaaaaaa|Points 3996|

User: You have a plant with yellow seeds, which express a dominant phenotype. How would you determine the plant's genotype?

Weegy: You should test cross with a purebred homozygous recessive plant. Because your plant is Yy (heterozygous) or YY (homozygous dominant), cross testing it with a yy will get you an answer. [ If you get all yellow phenotypes then the genotype for the plant in question will be homozygous dominant (YY) since crossing a YY with a yy will only lead you to Yy (Heterozygous) yellow plants. If you get any plants with the recessive trait then the plant in question MUST be Yy since only crossing a Yy with a yy will you get a plant that is homozygous recessive ]
goldenlight|Points 5216|

User: The presence of paired chromosomes makes a diploidgametehaploidgerm cell, while a single member of a pair of chromosomes makes a gametesomatichaploiddiploid cell. Question #10MultipleChoice Score: Comparative _____ suggests organisms that are more closely related have more similar embryo development. morphologyembryologyfossil records Question #11MultipleChoice Score: A plant with the genotype TT is called _____. homozygousheterozygoushybrid Question #12MultipleChoice Score: If the sperm gamete that fertilizes an egg has a(n) _____ chromosome, it will form male offspring. XYXYXX Question #13TextMultipleChoice Score: Convergent evolutionDivergent evolutionCoevolution is when different organisms evolve similar characteristics while coevolutionconvergent evolutiondivergent evolution evolution is when similar organisms evolve differently. Question #14TextMultipleChoice Score: Punctuated equilibriumGradualism is a slow, continuous process while punctuated equilibriumgradualism is sudden and less frequent. Question #15MultipleChoice Score: The second generation phenotypes resulting from the cross of purebred monohybrid pollination will display a ratio of _____. 2:24:13:1none of the above Question #16MultipleSelect Score: Select all that apply. Chromosomes _____. are tight coils of DNAare carried on genesalways occur in pairscan be analyzed in a karyotypecarry thousands of genes Question #17MultipleChoice Score: DNA _____. cannot determine behavior traitsis enclosed by a nuclear membrane in prokaryotescontains coded information for the creation of proteinsis a long, single chain of nucleotides Question #18MultipleChoice Score: A mouse with curled whiskers migrates from one forest community to another. She mates with other mice in the new community and passes the gene for curled whiskers to her offspring. This is an example of _____. genetic driftmutationgene flownatural selection Question #19MultipleChoice Score: Which of the following is the correct matching nucleotide sequence for CTAGG? CTAGGGATCCGGATCAGCTT Question #20MultipleSelect Score: Select all that apply. What is the difference between DNA and RNA? DNA is a protein and RNA is a nucleic acid.DNA uses deoxyribose and RNA uses ribose.DNA has adenine and RNA has thymine.DNA has thymine and RNA has uracil. Question #21MultipleChoice Score: If you flip two coins, the probability that both will come up heads is _____. 1/41/23/40/4 Question #22MultipleChoice Score: Which of the following statements is true? Acquired mutations are passed down from parent to offspring.Mutations are the most fundamental way to add new genes to a gene pool.Hereditary mutations are caused by external factors, such as radiation.Only somatic mutations are important to evolution because they can be inherited. Question #23TextMultipleChoice Score: You can physically see the genotypephenotype of a trait, but not the genotypephenotype . Question #24MultipleChoice Score: Microevolution _____. explores the connection between organisms of different speciesrefers to evolution at or below the species levelquestions how organisms become extinctrefers to evolution above the species level Question #25MultipleChoice Score: Suppose you have monohybrid pea plants in your garden and find that they produce round seeds to wrinkled seeds in the ratio of 3:1. If the alleles are designated R and r, respectively, what are the probable genotypes of the wrinkled seeds produced by your plants? RR & RrRR onlyRR & rrRr onlyrr only Question #26TextMultipleChoice Score: With the following crosses of pea plants, give the flower color of offspring and the ratio expected (red is dominant). A cross of red x red (both homozygous) would result in 2 red, 2 white3 red, 1 whiteall red1 red, 3 white. Question #27MultipleChoice Score: After crossing purebred red (dominant) and purebred white (recessive) flowers, pink flowers appeared. Using symbols, show the cross between pink and white flowers. Rr x rrRR x rrRr x RR

Weegy: Please ask just one question at a time. Thanks!
Expert answered|debnjerry|Points 43422|

Question
Asked 1/29/2013 1:01:41 PM
Updated 3/8/2014 6:06:49 AM
2 Answers/Comments
Edited by Janet17 [3/8/2014 6:00:05 AM], Edited by Janet17 [3/8/2014 6:04:41 AM]
New answers
Rating
3
Gradualism is a slow, continuous process while punctuated equilibrium is sudden and less frequent.

Added 3/8/2014 6:01:36 AM
This answer has been confirmed as correct and helpful.
3
The presence of paired chromosomes makes a diploid cell, while a single member of a pair of chromosomes makes a haploid cell, a gamete.

Added 3/8/2014 6:06:49 AM
This answer has been confirmed as correct and helpful.
Comments

There are no comments.

Add an answer or comment
Log in or sign up first.
31,734,420
questions answered
GET
Answers.
GET THE APP.
weegy*
*
Get answers from Weegy and a team of really smart live experts.
Popular Conversations
Specialized nerve cells are called
Weegy: Specialized nerve cells are called: Cells of the Nervous System.
5/21/2020 7:25:30 AM| 6 Answers
A_____can be used in the Senate to stop a bill from being passed.
Weegy: A filibuster can be used in the Senate to stop a bill from being passed. User: One main difference between ...
5/22/2020 6:01:14 AM| 5 Answers
Is the following sentence using a parenthetical expression correctly? ...
Weegy: f course, the girls, couldn't wait to jump in the pool on such a hot day.
5/26/2020 4:04:32 PM| 4 Answers
What is the primary purpose of photosynthesis
5/26/2020 1:56:07 PM| 4 Answers
Colors of German flag
5/25/2020 3:49:24 PM| 4 Answers
Cirrhosis of the liver is an effect of
Weegy: Cirrhosis of the liver is an effect of long term alcohol use.
5/24/2020 6:30:38 AM| 4 Answers
_______ was the first emperor in Roman empire from 27 BC – 476 AD.
Weegy: The first emperor in Roman empire was NOT from 27 BC to 14BC.
5/21/2020 7:20:16 AM| 4 Answers
Which NIMS Management Characteristic helps to eliminate confusion ...
Weegy: The National Incident Management System (NIMS) is a standardized approach to incident management developed by ...
5/29/2020 7:29:09 PM| 3 Answers
Share your beach.
W I N D O W P A N E
FROM THE CREATORS OF
weegy
WINDOWPANE is the live-streaming social network that turns your phone into a live broadcast camera for streaming to friends, family, followers, or everyone. Share what’s outside your window and all around you. Earn a little too.
Top Windowpane Earnings
$547.00
Hearts 13,313 Views 5,714,893 Streams 1,338
$528.00
Hearts 12,406 Views 5,335,559 Streams 1,280
$480.35
Hearts 9,863 Views 5,422,240 Streams 1,269
$428.30
Hearts 9,206 Views 1,717,787 Streams 428
$425.45
Hearts 9,822 Views 6,168,463 Streams 1,381
$391.10
Hearts 7,977 Views 4,894,365 Streams 1,201
$388.15
Hearts 8,135 Views 7,361,837 Streams 1,669
$375.50
Hearts 8,568 Views 4,460,723 Streams 1,091
S
L
R
L
Points 2032 [Total 5274] Ratings 5 Comments 1972 Invitations 1 Offline
S
L
P
R
P
R
L
P
P
C
R
Points 2031 [Total 9447] Ratings 6 Comments 1831 Invitations 14 Offline
S
L
P
R
Points 1878 [Total 4332] Ratings 2 Comments 1178 Invitations 68 Offline
S
L
Points 1606 [Total 2540] Ratings 1 Comments 1596 Invitations 0 Offline
S
L
Points 1274 [Total 2661] Ratings 0 Comments 1274 Invitations 0 Offline
S
L
Points 1010 [Total 1010] Ratings 0 Comments 1010 Invitations 0 Offline
S
L
Points 743 [Total 1911] Ratings 5 Comments 693 Invitations 0 Offline
S
L
R
R
Points 717 [Total 2411] Ratings 1 Comments 707 Invitations 0 Offline
S
L
P
P
P
1
P
L
Points 707 [Total 6498] Ratings 7 Comments 637 Invitations 0 Offline
S
L
R
Points 673 [Total 1967] Ratings 3 Comments 643 Invitations 0 Offline
* Excludes moderators and previous
winners (Include)
Home | Contact | Blog | About | Terms | Privacy | © Purple Inc.